Evidence of Bad Character Case Study

Evidence of Bad piece Case Study1.That Z had sex with T D HThe distinguish that Z had sex with T D H drive out be take overted with the matework forcet of completely the parties1. in m it is un credibly that Z would defy that this reason could be admitted thusly that X would have to rely on one of the separate victuals of percentage 100 (1) of the felonious arbiter Act 2003 in order to admit the certify. divide 100 (1) of the outlaw umpire Act 2003 stipulates, Evidence of the toughened character of a psyche other than the defendant is permissible if and yet ifIt is strategic explanatory essay,It has hearty probative none value in social intercourse to a matter which is a matter in recurrence in the legal proceeding, andis of secure importance in the context of the case as a whole, orall parties to the proceedings allot to the usher cosmos permissible and so it is likely that Z forget try and admit this leaven under s100(1)(b) arguing that it h as signifi placet probative value in similitude to a matter that is every a matter in issue in the proceedings or that is of corporeal importance in the context of the case as a whole. In order to determine whether or not the evidence has full-blooded probative value case law prior to the enactment of the iniquitous arbitrator Act 2003 should be considered where it was considered that such evidence could be admitted if it was collision likeity2and of sufficient probative force to overcome prejudice.3It is likely that this evidence pass on be admitted.2.That Z was convicted of wasting police epochThe evidence that Z had been convicted of wasting police time could again be admitted if both parties meet to the evidence being admitted. However it is unlikely that Z would agree that this evidence can be admitted therefore that X would have to rely on one of the other provisions of section 100 (1) of the nefarious legal expert Act 2003 in order to admit the evidence.Section 100 (1) of the vicious rightness Act 2003 stipulates that evidence of the worst character of a psyche other than the defendant is admissible if and only ifIt is important explanatory evidence,It has certain probative value in relation to a matter which is a matter in issue in the proceedings, andis of important importance in the context of the case as a whole, orall parties to the proceedings agree to the evidence being admissibleTherefore it is likely that Z will try and admit this evidence under s100(1)(b) arguing that it has unquestionable probative value in relation to a matter that is whatsoever a matter in issue in the proceedings or that is of substantial importance in the context of the case as a whole. In order to determine whether or not the evidence has substantial probative value case law prior to the enactment of the Criminal Justice Act 2003 should be considered, as above and in setting of that evidence it is unlikely that the evidence will be admitted. This does not come out of the closet to be of substantial importance and it is likely that the panel could reach the in effect(p) conclusion without hearing this evidence.3.That W is a lesbian who is prejudiced against menThe evidence that W is a lesbian who is prejudiced against men can be admitted with the organisation of all the parties4. However it is unlikely that W would agree that this evidence could be admitted therefore that X would have to rely on one of the other provisions of section 100 (1) of the Criminal Justice Act 2003 in order to admit the evidence.Section 100 (1) of the Criminal Justice Act 2003 stipulates, evidence of the regretful character of a person other than the defendant is admissible if and only ifIt is important explanatory evidence,It has substantial probative value in relation to a matter which is a matter in issue in the proceedings, andis of substantial importance in the context of the case as a whole, orall parties to the proceedings agree to the ev idence being admissibleTherefore it is likely that Z will try and admit this evidence under s100(1)(b) arguing that it has substantial probative value in relation to a matter that is every a matter in issue in the proceedings or that is of substantial importance in the context of the case as a whole. On this basis it is unlikely that this evidence will be admitted.4.Psychiatric evidence in respect of YThe evidence that Y is suffering from Potipahrs Wife Syndrome can be admitted by agreement by the parties. 5 However it is unlikely that Y would agree that this evidence could be admitted therefore that X would have to rely on one of the other provisions of section 100 (1) of the Criminal Justice Act 2003 in order to admit the evidence.Section 100 (1) of the Criminal Justice Act 2003 stipulates that evidence of the hard character of a person other than the defendant is admissible if and only ifIt is important explanatory evidence,It has substantial probative value in relation to a mat ter which is a matter in issue in the proceedings, andis of substantial importance in the context of the case as a whole, orall parties to the proceedings agree to the evidence being admissibleX will need to argue that the evidence is important explanatory evidence. Evidence is important explanatory evidence for these purposes if (a) without it, the solicit or panel would find it impossible or difficult properly to understand other evidence in the case, and (b) its value for understanding the case as a whole is substantial6. Except in relation to evidence of conduct, which is alleged to be similar to matters in dispute at the trial, evidence of witnesss tough character may not be adduced without the leave of the court7. Section 100(3) identifies certain concomitantors to be taken into account by the trial judge, on board any others considered applicable, in exercising his discretion to grant leave to take bad character evidence to be wedded. Such factors include the count of relevant incidents, the lapse of time, and other common sense considerations relating to similarities surrounded by sometime(prenominal) and present conduct and questions of contested identity. Therefore such evidence will only be admitted if it bears substantial probative value, and the court grants leave. It would therefore be concluded that in this instance that the evidence would be admitted.5.Previous evidence of VAssuming as discussed above that the X is not successful in admitting any of the evidence (as if he is this will mean that the evidence of his bad character and introductory credendums will automatically be admitted) the Criminal Justice Act 2003 contains a dedicated evasion of rules to regulate the admissibility of evidence of the accuses extraneous wrongful conduct in s101 (1). These rules argon different from those rules that cost for the admittance of other witnesss precedent character.In execrable proceedings evidence of the defendants bad character is a dmissible if, but only if all parties to the proceedings agree to the evidence being admissible,the evidence is adduced by the defendant himself or is given in state to a question asked by him in cross-examination and mean to elicit it,It is important explanatory evidence,It is relevant to an important matter in issue betwixt the defendant and the pursuitIt has substantial probative value in relation to an important matter in issue between the defendant and a co-defendant,It is evidence to correct a false whim given by the defendant, ofThe defendant has made an attack on another(prenominal) persons characterTherefore this evidence can be admitted by agreement by the parties however this is unlikely. Therefore it is likely that the pursuance will examine to admit the evidence under sections c and d and this are provisions, which are concerned with similar fact evidence. One of import dimension of the similar facts cases concerned the dangers posed by deliberate tacit consent between witnesses or innocent cross-taint of their evidence.In determining the admissibility of evidence of the accuses misconduct in the first instance, however, section 109 obliges the court to interact the evidence as true, unless it appears, on the basis of any material earlier the court (including any evidence it decides to hear on the matter), that no court or instrument panel could reasonably find it to be true8. Therefore given the similarities between the previous incident and the current one it is likely that this information will be allowed to be admitted into the current proceedings. The reason for this is that the evidence can all be considered to be important explanatory evidence or alternatively that it is relevant to an important matter in issue between the defendant and the prosecution6.Xs previous conviction of ExposureThe CJA 2003 contains a dedicated scheme of rules to regulate the admissibility of evidence of the accuseds extraneous misconduct in s101(1)In cruel proceedings evidence of the defendants bad character is admissible if, but only if all parties to the proceedings agree to the evidence being admissible,the evidence is adduced by the defendant himself or is given in answer to a question asked by him in cross-examination and intended to elicit it,It is important explanatory evidence,It is relevant to an important matter in issue between the defendant and the prosecutionIt has substantial probative value in relation to an important matter in issue between the defendant and a co-defendant,It is evidence to correct a false impression given by the defendant, ofThe defendant has made an attack on another persons characterTherefore this evidence can be admitted by agreement by the parties however this is unlikely. Therefore it is likely that the prosecution will attempt to admit the evidence under sections c and d and this are provisions, which are concerned with similar fact evidence. One significant dimension of the similar facts cases concerned the dangers posed by deliberate collusion between witnesses or innocent cross-contamination of their evidence.In determining the admissibility of evidence of the accuseds misconduct in the first instance, however, section 109 obliges the court to treat the evidence as true, unless it appears, on the basis of any material before the court (including any evidence it decides to hear on the matter), that no court or jury could reasonably find it to be true9.Section 107 where evidence of the accuseds bad character has been admitted into the trial without the accuseds agreement, under section 101(1) paragraphs (c)-(g), and the court is satisfied at any time after the close of the prosecutions case that (i) that evidence is begrime such that (ii) a conviction would be unsafe, the court must every direct the jury to acquit the defendant of this offence or, if it considers that there ought to be a retrial, discharge the jury. Either way, proceedings will not be allowed to c ontinue if it emerges during the course of the trial that material evidence of bad character has been begrime.A previous conviction can be admitted as evidence of propensity if it falls into any (i) one of the categories of offences or (ii) the bidding of the offence in a written charge or bill of indictment would be the same. Thus, a person who has been convicted of actual bodily harm and is without delay charged with actual bodily harm will fall into the southward category (same description)-but a person who has been convicted of theft and is now charged with burglary would not. However, the radix Office will introduce two sets of categories of offences-the first broadly comprising all Theft Act offences, the second comprising sexual offences involving sexual contact with children.Therefore given the similarities between the previous incident and the current one it is likely that this information will be allowed to be admitted into the current proceedings. The reason for th is is that the evidence can either be considered to be important explanatory evidence or alternatively that it is relevant to an important matter in issue between the defendant and the prosecution7.Directing the JuryBecause of the statutory grounding of the criminal evidence rules the rules on directing the jury, in relation to similar fact evidence and evidence of bad character have altered somewhat. The provisions that we are concerned with here are contained within Section 107 where evidence of the accuseds bad character has been admitted into the trial without the accuseds agreement, under section 101(1) paragraphs (c)-(g), and the court is satisfied at any time after the close of the prosecutions case that (i) that evidence is contaminated such that (ii) a conviction would be unsafe, the court must either direct the jury to acquit the defendant of this offence or, if it considers that there ought to be a retrial, discharge the jury. Either way, proceedings will not be allowed t o continue if it emerges during the course of the trial that material evidence of bad character has been contaminated.Finally, there is a power for the court to discharge the jury and either direct an acquittal or order a retrial if a judge, having admitted evidence of bad character, later decides that such evidence was contaminated. Contamination is outlined in terms of evidence that is false or misleading in any respect, as a result of the witness who gave the evidence either having agreed to give false evidence, or being affected by hearing other evidence in the case. It seems these provisions are aimed oddly at allegations of multiple sexual abuse where other allegations are, on occasion, felt up to be the consequence of collaboration by different witnesses. In such cases it would be open to the judge to cure the problem by tutelage to the jury, but where it is felt that direction is inadequate and any subsequent conviction would be unsafe, the judge is empowered to discharge the jury.In conclusion therefore if the judge is satisfied with the evidence and there is no evidence of contamination or collusion then this evidence of the defendants previous bad character will be admitted.BibliographyLegislationCriminal Justice Act 2003BooksDennis I, (2002) The Law of Evidence, Sweet and MaxwellHuxley P OConnell M, (2004) Statutes on Evidence, Oxford University take the fieldMcEwan J, (1998) Evidence and the Adversarial Process, Hart Publishing tapper C, (2003) Cross and Tapper on Evidence, Oxford University PressZuckermann A Roberts P, (2004) Criminal Evidence, Oxford University Press1Footnotes1 S100 (1) (C)2 DPP v Boardman 1975 AC 421 HL3 DPP v P 1991 2 AC 447 at 4604 S100 (1) (C)5 S100 (1) (C)6 S100(2)7 S100(4)8 S 109 (2)9 S 109 (2)

Encoding RIP from Elaeis Guaneensis Jacq

Encoding RIP from Elaeis Guaneensis JacqDetection and human face compose of two novel transcripts convert RIP from Elaeis guaneensis Jacq. in Ganoderma boninense fundamental interaction1. IntroductionAmong several cover-producing plants, anoint colour plow (Elaeis guineensis) is a tropical set out which is exclusively grown for oil production. Its high oil yield is extracted from oil bay wreaths thick fleshy mesocarp which is extremely rich in oil (80% of dry mass). Furthermore, oil palm has the highest oil production (oil per whole land) compargond to other oil-producing plants. The extracted oil has been apply widely for several applications including, food, cosmetics, and bio-fuel (Paterson 2007 Murphy 2009 Alizadeh et al. 2013).Among variant diseases , the base stem rot (BSR) is known to be the most spartan disease in oil palm (Ho and Nawawi 1985). Furthermore, the BSR is caused by Ganoderma boninense which is considered specifically as a white rot fungus. The ligni n is broken by the fungus leaving milky mobile phoneulose exposed (Paterson 2007). The infection process is initiated when the oil palm roots be penetrated by fungous mycelia, which is spread out to the stem bole, after which the ashes eventually collapses (Rees et al. 2009). Malaysia and Indonesia gestate suffered the most severe losses from the BSR furthermore, the diseases has been identified in Malaysia several decades ago (Ho and Nawawi 1985 Idris et al. 2004 Rees et al. 2007).Oil palms of diametric elementtic origins have shown to have resistance to BSR. However, the genes involved in the resistance of oil palms against G. Boninense were unknown (Idris et al. 2004 Durand-Gasselin et al. 2005). Recently, some defence related genes were identified in oil palm. The major pathogen on oil palm in Malaysia has been identified as G. boninense Pat. Stem rots of oil palm caused by species of Ganoderma ar a major threat to the sustainability of the oil palm production. In this study, we have isolated one complementary deoxyribonucleic acid encoding RIPs EST, from oil palm. Its grimace in oil palm root infected by G. boninese was investigated to shed light on its electric potential involvement during early disease development.2. Materials and methods2.1 Sample preparationA fit of 24 six-month-old oil palm seedlings (Elaeis guineensis Jacq., DxP, GH500 series) were purchased from Sime Darby go underation Sdn. Bhd. (Banting Malaysia) and divided into two groups with 12 seedlings in all(prenominal) group, one of these groups were treated with Ganoderma boninense Pat. Strain PER71, speckle the be group served as pull stringss. Seedlings treated with G.boninense were inoculated by sitting each seedling on rubber woodblock fully grown with G.boninense PER71 while the other group of seedlings were inoculated with fungal surface mulch as described by (Alizadeh et al., 2011). Three biologic restates of the seedlings were harvested from each manipulatio n at 4, 8, 12 wpi, individually. The leaves, roots and stem cellular telephone were frozen in liquid nitrogen and stored at -80C (Tan et al., 2013).2.2 ribonucleic acid extraction fundamental ribonucleic acid was extracted from treated and untreated oil palm root interweaves exploitation a modified CTAB method briefly, 0.1 g create from raw stuff was ground in liquid nitrogen into a very influence powder. The powder was immediately transferred into 1.5 ml extraction CTAB buffer 2% (w/v) cetyl trimethyl ammonium bromide, CTAB 100mM Tris-HCl, pH 8.0 2M NaCl 25 mM ethylenediamineteraacetic acid, EDTA pH 8.0 2% (w/v) polyvinylpyrrolidone, PVP and 2% (v/v) -mercaptoethanool. constitute mint of chloroform/isoamylalcohol (241, v/v) was added into the tube and centrifuged at 12,857 g for 15 min at 4C. The upper layer was transferred into a untried tube and equal volume of phenol/chloroform/isoamylalcohol (25241, v/v/v) was added and centrifuged. This step was repeated until a clea r supernatant was obtained. The supernatant was adjusted to a final concentration of 2M LiCl, and incubated at 4C for overnight, and then centrifuged. The RNA was dissolved in 5ml diethypyrocarbonate (DEPC) treated water. An equal volume of chloroform/isoamylalcohol was added, mixed, and centrifuged at 12,857 for 30 min at 4C. temerity of RNA was performed by adding 0.1 vol of 3M sodium acetate (pH 5.2), 2 vol 100% ethanol and incubated at -80C for overnight. After centrifugation, the pellet was washed utilise 70% ethanol and dissolved in 20ul DEPC-treated water. The quality of RNA was examined by using a Nanodrop( BioRad) at 230, 260 and 280 nm. The RNA integrity was examined using 1.5% agarose gel electrophoresis. The RNA was treated with DNase I (Qiagen, USA) following the manufacturers instructions.Figure Total RNA from various treated and untreated oil palm tissues. pass A Untreated control seedling. Lane B Treated seedlings. 1) Leaf. 2) meanspirited stem. 3) Root3. Sem i-quantitative Reverse transcriptase (RT-) PCR3.1 Isolation of complementary DNAOmniscript Reverse transcriptase turnout (Qiagen Kit) was used for cDNA synthesis by the following kit manuscript. To obtain the ecological succession of cDNA from oil palm, gene specific primers were knowing based on oil palm expressed sequence pit (EST) (Ho, 2010) and RIPs font I conglutinations, using primer 3 version 0.4.0(frodo.wi.mit.edu).3.2 Sequence outline of cDNASemi-quantitative Reverse transcriptase (RT-) PCR was performed on EST using PCR machine with Reverse transcriptase enzyme. Equal amounts of RNA (1ug) extracted from control and treated oil palm root samples were converted into cDNA by using the Omniscript two step Reverse Transcription Kit for cDNA Synthesis (Qiagen, USA) following the manufacturers instructions. The resulted sequences shown significant similarities to RIP (Naher et al., 2011).3.3 scene profiling twist take aims were calculated by Quantity One 1-D synopsis software 4.6.5 (Bio-Rad) according to the manufacturers instructions. PCR products were resolved on 1.5%(w/v) agarose gel (1xTAE) with a DNA mass standard marker (MassRuler TM DNA Ladder, Fermentas). The density of the DNA mass standard dilution series was used to breed calibration curve for absolute quantisation of sample exercise sets by analogue regression with extrapolation to zero for each experiment. The density of each sample band was then converted to an absolute quantity using the calibration curve. For each sample band was then converted to an absolute quantity using the calibration curve. For each experiment, the sexual congress band quantity obtained by densitometrric analysis was normalized to the value of the internal control (house-keeping gene) bands which were run in parallel. Identification of differentially expressed genes was based on consistent ford-change across experimental replicates relative to untreated negative control. Fold changes of 2- fold or 0.5-fo ld were considered as significant.3.4 statistical analysisA one-way analysis of variance (ANOVA) was used to sic statistical differences (SPSS version 17SPSS Inc., Chicago, IL). When the ANOVA was significant at P 0.05 the Duncans multiple range test was used for means comparison. The t-test was used to compare between group means.(Alizadeh et al., 2011)4. Results4.1 sequence analysis EgRIP-1bThe uncomplete cDNA of EgRIP-1b (Dr. Ho personal comment) encodes a putative type I ribosome inactivating protein. The partial sequence consists 167 foundation residues. (Fig. 2). This sequence has the highest identity with RIP type I from Populus trichocarpa (98%, XP_002328056.1), Hordeum vulgare (90%, AAA32951.1) and Chain A, Structure Of Mutant Rip From barley Seeds (90%, 4FBA_A). The NODE_77734GT was classified in a RIP-like superfamily. A putative keep plain of catalytic residues and some RIP family domain were in this sequence, including that it is a fellow member of the RIP superfa mily.(Fig. 5)(Naher et al., 2011)M I C E S I R F E R I S E F L A T E F P G S S K P P KTGATGATCTGCGAGTCGATTAGATTCGAACGCATCTCCGAATTTCTTGCTACCGAATTCCCCGGCAGTTCGAAACCCCCTAAAW M P A L E H G W G D L S A A L L R A D A N P D R P FTGGATGCCGGCACTCGAGCACGGCTGGGGAGATCTCTTTGCCGCGTTGCTGCGCGCCGATGCCAATCCCGACCGTCCCTTCAFig. 2. The nucleotide and deduced amino acid sequences of NODE_77734GT.4.2 sequence analysis EgRIP-1aThe partial cDNA sequence EgRIP-1a (GenBank ID ) encodes a protein of 17 amino acid. The sequence consists 178 nucleotides (Fig. 3). This sequences has the highest identity with other type I RIPs from Nicotiana tabacum (47%, ABY71831.1), Musa acuminate (47%, ABY71832.1), Alocasia macrorrhizos (47%, ABY71829.1), Agave sisalana (47%, ABY71828.1) (Fig. 6.a) and (Fig. 6.b)M R P T P N F H Y E W S ACAGGATTCCAGCCGAGCTCCTGCGATAGCCGAACTTCTACCACATGCGACCTACTCCAAACTTCCACTACGAGTGGTCTGCTCL S K QTCTCCAAACAAFig. 3. The nucleotide and deduced amino acid sequences of EgRIP-1a.Fig. 4 multiple alignment of NODE with other type I RIPs. Amino acid residues that are identical in all sequences are highlighted in black while amino acid residues that are highly conserved are highlighted in gray dashes represent gaps introduced to maximize the alignment.(a)(b)Fig. 5 Multiple alignment of EgRIP-1a with other RIPs. The protein sequences and their accession numbers used for analysis of detected sequence. a) Nucleotide residues that are highly conserved are highlighted in gray dashes represent gaps introduced to maximize the alignment. b) Amino acid residues that are identical in all sequences are highlighted in black with amino acid residues that are highly conserved are highlighted in gray dashes represent gaps introduced to maximize the alignment.4.3 Expression profiles (of RIP) in oil palm root upon Ganoderma inoculationA total of 2 cDNA sequences encoding putative defence-related proteins from oil palm were chosen for gene materialization profiling in this study. A relative semi-quantif ication of EgRIP-1b and EgRIP-1b transcripts were performed by calibrating the expression of each gene with an endogenous control, actin. Fig.6 Shows the relative expression level of EgRIP-1b in roots and basal stems in repartee to the inoculation of G. boninense at different time points compared with that of negative control plants. In G. boninense-treated plants, the gene expression of EgRIP-1b in oil palm roots at 2 wpi was induced. The expression level were n- and n-fold of the uninfected root tissues at 8 and 12 wpi, respectively.(Naher et al., 2011) The expression level was studied in 3 replication of each sample, there were no significant (P0.05) differences in expression levels in inoculated plants (Alizadeh et al., 2011).EgRIP-1a was up-regulated n-fold and n-fold at X wpi, respectively before the transcript level decrease at Y wpi in oil palm root tissue following G.boninense infection (Fig). EgRIP-1a expression level were m-, m- and m-fold of the uninfected basal stem ti ssues at 2,4, 8 and 12 wpi, respectively. EgRIP-1b and EgRIP-1a were not expressed in time zero, untreated samples and leaf tissues.(I) pathologic (II) well-informed(a) (b) (c) Fig. 6. Differential expression of EgRIP-1b in variety tissues in response to I) G.boninese treatment compare to those in II )control.. a) root tissue, b) stem cell tissue, c) standard (Rippmann et al., 1997)a) b)Fig. 7. Expression level mean in each biologic replicate a) in root b) in stem(I) diseased (II) healthy(a) (b) (c) Fig. 8. Differential expression of EgRIP-1a in variety tissues in response to I) G.boninese treatment compare to those in II) control.. a) root tissue, b) stem cell tissue, c) leaf tissue d)control (Rippmann et al., 1997)a) b)Fig. 9. Expression level mean in each biological replicate a) in root b) in stemFig. 10. Semi-quantification of oil palm EgRIP-1a and EgRIP-1b expression levels in root tissues at 2-12 week after inoculation with G.boninense. substantive up-regulation of g ene expression compared to untreated negative control.ReferencesAlizadeh F, Abdullah SNA, Chong PP, Selamat A Bin (2013) Expression Analysis of Fatty Acid Biosynthetic Pathway Genes during Interactions of Oil laurel wreath (Elaeis guineensis Jacq.) with the Pathogenic Ganoderma boninense and Symbiotic Trichoderma harzianum Fungal Organisms. Plant Molecular Biology Reporter. inside 10.1007/s11105-013-0595-yDurand-Gasselin T, Asmady H, Flori a, et al. (2005) Possible sources of genetic resistance in oil palm (Elaeis guineensis Jacq.) to basal stem rot caused by Ganoderma boninenseprospects for future breeding. Mycopathologia 15993100. inside 10.1007/s11046-004-4429-1Ho YW, Nawawi A (1985) Ganoderma boninense Pat . from Basal Stem Rot of Oil ornament ( Elaeis guineensis ) in Peninsular Malaysia. Pertanika 8425428.Idris AS, Kushairi A, Ismail S, Ariffin D (2004) SELECTION FOR partial tone RESISTANCE IN OIL PALM PROGENIES TO Ganoderma BASAL STEM ROT. journal of Oil Palm Research 161218. Murphy DJ (2009) Oil palm future prospects for yield and quality improvements. Lipid technology 21257260. doi 10.1002/lite.200900067Paterson R (2007) Ganoderma disease of oil palmA white rot perspective necessary for integrated control. Crop Protection. doi 10.1016/j.cropro.2006.11.009pilotti CA (2005) Stem rots of oil palm caused by Ganoderma boninense Pathogen biology and epidemiology. Mycopathologia 159129137.Rees RW, spring J, Hasan Y, et al. (2009) Basal stem rot of oil palm ( Elaeis guineensis ) sense modality of root infection and lower stem invasion by Ganoderma boninense. Plant Pathology 58982989. doi 10.1111/j.1365-3059.2009.02100.xRees RW, Flood J, Hasan Y, Cooper RM (2007) Effects of inoculum potential, blend and soil temperature on root infection of oil palm seedlings by the basal stem rot pathogen Ganoderma boninense. Plant Pathology. doi 10.1111/j.1365-3059.2007.01621.xTan Y-C, Yeoh K-A, Wong M-Y, Ho C-L (2013) Expression profiles of putative defence-related prote ins in oil palm (Elaeis guineensis) colonized by Ganoderma boninense. Journal of plant physiology. doi 10.1016/j.jplph.2013.05.009

Matson Evaluation of Social Skills with Youngsters-II

Matson Evaluation of amicable Skills with Youngsters-IIThe Matson Evaluation of affable Skills with Youngsters-II (mussy-II) and Its alteration for Persian electric shaverren and Adolescents with Intellectual DisabilityBakhtiyar Karami, Mojtaba Gashool, Shoaib Ghasemi, Hamid AlizadehAbstractThe aim of the present field of operations was to evaluate the psychometric properties and federal agent body structure of the Matson Evaluation of Social Skills with Youngsters-II (mussy-II)in a community population in Iran. The Iranian mutation of the MESSY-II was administered by interviewing direction staff of alone children and adolescents (n = 355) with administratively delimit intellectual disabilities (IDs) life story in Tehran,Esfahan, Karaj Kordistan. Confirmatory constituent psycho compend supported the unidimensionality of the subscales as well as the proposed two factor structure of the original MESSY-II. The present study demonstrates that the troika subscales argon hi ghly similar constructs crosswise different language and heathenish settings, and that the MESSY-II is applicable in research on populations with varying mental functioning, diagnoses, ages, and keep arrangements.Keywords Social skills, Assessment, MESSY, Rating scale, promoter structureIntroductionThe development of mixer skills is an important process in young childhood and adolescence. Deficits present in childhood that argon left undetected and/or untreated behind lead to increased problems into adulthood (Greene et al., 1999). In addition, impairments in geniusly skills may be related to larger problems such as developmental disability, concern deficit/ hyperactivity disorder (ADHD), depression, anxiety, anti amicable behavior, and early(a) mental health problems (Davis et al., 2011 Lugnegard, H all(prenominal)enback, Gillberg, 2011 Mahan Matson, 2011 Matson Wilkins, 2009 Worley Matson, 2011). Social skills deficits may occur as a result of these disorders or as p art of the disorders themselves. As a result, identification of neighborly weaknesses is essential for providing give-and-take and improving prognosis and quality of life. Identifying social strengths is also important for word and clear guide clinicians to use assets that the child already possesses to help make break off the areas of deficit.The assessment and facts of life of social and adaptive skills is important for a topic of reasons. First, social and adaptive skills deficits can compromise successful transition from institutional to community living (Jacobson Schwartz, 1991 Doll, 1953). warrant, deficits in these areas may contribute to the etiology of psychiatric disorders and behavioral problems (Borthwick-Duffy Eyman, 1990 Matson Sevin, 1994). Finally, social and adaptive deficits often persist in living areas where the philosophy of care consists of passive learning rather than active preaching (Matson Hammer, 1996).The MESSY (Matson, 1988) was developed i n 1983 for assessing the social skill deficits of children aged 4 to 18. The original normative sample at the time was based on 744 typically developing children in Northern Illinois (Matson, Rotatori, Helsel, 1983). The initial items included in the measure were based on a review of standardized measures, including items that address social behaviors. Two independent raters then selected the items believed to fit the definition of social skills. These 92 items were then administered to 422 children( self- idea form) and 322 teachers (teacher-report form) twice, at a 2-week interval. Test-retest reliability was conducted and items with Pearsons correlations greater than .50 and .55 for the self- and teacher-report variates, respectively, were bear. The results yielded 62 items for the self-report form and 64 items for the teacher-report form. Original tests of reliability and hardship bespeakd conceptive internal eubstance and test-retest reliability andadequat convergent v alidity (Matson et al., 1983).The MESSY has been translated into 9 other languages and researched internationally Spanish (Mendez, Hildalgo, Ingles, 2002), Chinese (Chou, 1997), Japanese (Matson Ollendick, 1988), Dutch (Prins, 1997), Hindoo (Sharma, Sigafoos, Carroll, 2000), Hebrew (Pearlman-Avnion Eviator, 2002), French (Vert, Roeyers, Buysse, 2003), Turkish (Bacanli Erdoan, 2003), and Slovakian (Vasilo (Bacanli Baumartner, 2004). In addition, the MESSY has been researched with various populations, including children with hearing and visual impairments (Matson, Heinze, Helsel, Kapperman, Rotatori, 1986 Matson, Macklin, Helsel, 1985 Raymond Matson, 1989) , intellectual disabilities (Matson Barrett, 1982), anxiety disorders (Strauss, Lease, Kazdin, Dulcan, Last, 1989), depression (Helsel Matson, 1984), bipolar disorder (Goldstein, Miklowitz, Mullen, 2006), and autism spectrum disorders (Matson, Stabinsky-Compton, Sevin, 1991).2222However, in that location is still n o agreement ab unwrap which factorial structure best explains the data because the results of former studies showed a different enactment of factors and different arrangements of items. Thus, the objectives of the present study are to examine the psychometric properties of the MESSY for the first time in an Iranian sample and to compare the results to forego studies with the MESSY in other socio-cultural contexts.1. Method1.1. ParticipantsThirty hundred and liter five 355 (223 male, 132 female) participants were recruited from undergraduate psychology courses. Their ages ranged from 3 to 26 years, with a think about age of 11.34 years (SD = 3.87). According to clinical practice in Iran, the participants were class into having a mild (40.8%), moderate (47.0%), severe (11.3%), or profound (0.8%) direct of mental retardation. The most frequent diagnoses were Downs syndrome (53.8%), autism (20.8%), mentally slow down (16.9%), and 8.5% of the individuals were reported to carry ot her disorders.1.2. MeasuresMatson Evaluation of Social Skills with Youngsters-II (MESSY-II Matson et al., 2010). The MESSY-II is a social skills measure for a broad range of children, ages 216, based on observations of both appropriate and inappropriate social behaviors. This measure is a renormed version of the original MESSY, which was designed to assess social skills in children ages 418 (Matson, Rotatori, et al., 1983). The original scale had two different forms a self-report form and fire/teacher report form consisting of 62 and 64 items, respectively. At present, the MESSY-II whole has one form, which is a get up/caregiver report form. During the renorming process it was obdurate that social skills would best be examined through parent/caregiver report as opposed to self- report due to difficulties with poor insight in the populations frequently administered the MESSY. Also, since the measuresutility has largely been clinic and community focused, there is a decreased need for a teacher report form. The MESSY-II has 64 items identical to the original MESSY parent/teacher report form, which are each rated on a Likert-type rating scale from 1 ( nonat all) to 5 ( rattling much). Recent studies indicate that the scale has strong psychometric properties including internal consistency, and convergent and divergent validity (Matson et al., 2010). Although the original MESSY parent/teacher report form yielded a two factor structure (i.e., Inappropriate self-assertiveness/Impulsiveness scale and eliminate Social Skills scale), the factor structure of the MESSY-II has yet to be established.1.3. ProceduresThe participants for this investigation were recruited throughout the children adolescents who enrolled in exceptional children schools. We first select 4 state Tehran, Esfahan, Alborz Kordistan randomly and then separate a list of exceptional children schools in this 4 state. After permission from authorities (Misinstry of Education in each city), the j udgment teachers were contacted in order to coordinate the data collection processes. Then, after training the head teacher about MESSY-II in an agreed date teachers were asked to achieve a paper and pencile version of the final draft of the Iranian version of MESSY-II for each student time one of us (AMo) was present in the agreed school for any possible help or inquiries. information collected in about 1 month.1.4. Data AnalysisIn order to determine the factor structure of the MESSY-II, an exploratory factor analysis with Principle axis factoring was used on the 64 items of the MESSY-II. addicted the likelihood of correlations among the underlying constructs of the factors, an oblique promax rotation was used (brown, 2006). The optimal factor structure was determined via trial run of the scree plot, and comprehensibility of factors (zwick velicer, 1986). Items with factor loadings greater than .30 were retained for each factor (kline, 2000). Internal consistency of the facto rs was examined utilize Cronbachs alpha (Cronbach, 1951) and the 0.70 criterion for adequate reliability (Nunnally Bernstein, 1994).2. ResultsExploratory factor analysis yielded a two-factor solution for the MESSY-II. The come in variance accounted for by the two- factor posture was 41.43%. Inappropriate Assertiveness/Impulsiveness factor accounted for 29.37% of the variance. Appropriate Social Skills factor accounted for 12.6% part of the variance. The correlation between two factors was moderate r= .410. Two items (i.e., item 20 Is afraid to speak to people and item 46 Feels lonely) did not meet the criteria of .30, and were removed from the measure. Table 1 lists the factors and corresponding items.Next, internal consistency was examined for the two factors of the MESSY-II using Chrobachs alpha. Inappropriate Assertiveness/Impulsiveness had an internal consistency of .950 (M=70.58 SD=24.87), and Appropriate Social Skills had an internal consistency of .952 (M=75.64 SD=24.91) . corrected Item-total correlations were considered for each of the retained factors to determine if the removal of additional items was warranted due to coefficients below 0.30 (Field, 2005). Item total correlations of Inappropriate Assertiveness/Impulsiveness subscale ranged from 0.42 (item 15) to 0.70 (item 9, 17, and 52). item total correlations of Appropriate Social Skills subscale ranged from 0.37 (item 19) to 0.77 (item 41).since no item on any of the scales had a correlation of less than .30 and, therefore, all items were retained following the two items that had been removed during the exploratory factor analysis.3. preachingImpairments in social skills are a defining aspect of developmental disabilities, and deficits in these skills can affect the ability of children, adolescents, and adults to progress in other areas across the spectrum of development. Furthermore, social deficits are major risk factors for challenging behaviors (Farmer Aman, 2009 Tenneij, Didden, Stolk er, Koot, 2009), and similarly, they can compound problems of psychopathology (Brim, Townsend, DeQuinzio, Poulson, 2009 Matson, Dempsey, Rivet, 2009 Niklasson, Rasmussen, O skarsdo ttir, Gillberg, 2009 Rose, Bramham, Young, Paliokostas, Xenitidis, 2009). For these and other reasons, the development of measures of social skills is very important (Matson Boisjoli, 2009a, 2009b Matson Dempsey, 2009 van den Hazel, Didden, Korzilius, 2009).The purpose of this paper then, was to determine the factor solution of a measure used to assess social skills, the MESSY-II in Iranian population (Matson et al., 2010). The original MESSY was initially developed some three decades ago, but recently renormed (see Matson et al., 2010). Exploratory factor analysis of the MESSY-II yielded a three factor solution. Two of the factors were consistent with inappropriate social skills while the other consisted of items relating to appropriate and adaptive social skills.The data were collected as part of an epidemiological research program including all children adolescents with administratively defined ID living in 4 state Tehran, Esfahan, Alborz Kordistan. Overall, the results showed that the internal consistency of the Iranian MESSY-II is in line with previous research on the MESSY-II and that the proposed two-factor model had an agreeable fit.This study showed satisfactory cultural adaptation, reliability, content validity and factor structure for the Iranian version of MESSY-II. However, considering the study limitations, the findings should not be frequentized. In general this instrument will be a valuable teacher/parent reported measure for the evaluation of social skills (Inappropriate Assertiveness/Impulsiveness Appropriate Social Skills) among children adolescents with mental retardation in Iran and other Persian-speaking countries.Table 1 Factor structure of the MESSY-IIItem no.Factor 1 Inappropriate Assertiveness/ImpulsivenessFactor 2 Appropriate Social Skills1 Makes others laugh.4842Threatens people or acts like a bully.7703Becomes maddened easily.6884Is bossy (tells people what to do instead of asking).5415Gripes or complains often.6386Speaks (breaks in) when someone else is speaking.7027Takes or uses things that are not his/hers without permissionwithout permission.5358Brags about self.5769Slaps or hits when angry.75311Gives other children dirty looks.67712Feels angry or jealous when someone else does well.61513Picks out other Childrens faults/mistakes.56115Breaks promises.46416Lies to get what he/she wants.53717Lies to get what he/she wants.73421Hurts others feelings on purpose.58722Is a sore loser.60123Makes fun of others.61624Blames others for own problems.61929Is stubborn.70332Thinks people are picking on him/her when they are not.51735Makes sounds that bother others.54836Brags too much when he/she wins.52638Speaks too loudly.53243Always thinks something bad is red ink to come about.42748Gets upset when he/she has to wait for thi ngs.45052Gets in fights a lot.73653Is jealous of other people.46757Stays with others too long (wears out welcome).52958Explains things more than infallible.37660Hurts others to get what he/she wants.74662Thinks that winning is everything.48363Hurts others feelings when dirty them.75964Wants to get even with someone who hurts him/her.71710Helps a friend who is hurt.67214Always wants to be first.58518Walks up and initiatesconversation.4709Slaps or hits when angry.34025Sticks up for friends.60826Looks at people when they are speaking.75927Thinks he/she knows it all.316.493a28Smiles at people he/she knows.58630Acts as if he/she better than others.67531Shows feelings.65933Thinks good things are going to happen.47434Works well on a team.83437Takes care of others property as if it were his/her own.76739Calls people by their names.60740Asks if he/she can be of help.81141Feels good if he/she helps others.83942Defends self.59844Tries to be better than everyone else.74145Asks questions when talking with others.67147Feels sorry when he/she hurts others.58949Likes to be the leader.381.468 a50Joins in games with other children.76751Plays by the rules of a game.81254Does nice things for others who are nice to him/her-.362.712 a55Tries to get others to do what he/she wants.354.368 a56Asks others how they are, what they have been doing, etc..57959Is friendly to new people he/she meets.71361Talks a lot about problems or worries.312.433 aReferencesKline, P. (2000) an liberal guide to factor analysis. Routledge, London.Nunnally J. C. Bernstein I. (1994) Psychometric Theory. McGr59aw-Hill, NewYork, NY.Zwick, W. R., Velicer, W. F. (1986). Comparison of Five Rules for Determining the derive of Components to Retain. Psychological Bulletin, 99(4) 432-442.Brown, T. A. (2006). Confirmatory factor analysis for applied research. New York Guilford Press.Field, A. (2005). Discovering statistics using SPSS. London Sage Publications IncCronbach, L. J. (1951). Coefficient alpha and the i nternal structure of tests. Psychometrika, 16(3), 297334.Davis, T. E., III, Hess, J. A., Moree, B. N., Fodstad, J. C., Dempsey, T., Jenkins, W. S., et al. (2011). Anxiety symptoms across the lifespan in people diagnosed with autism disorder. Research in Autism Spectrum Disorders, 5, 112118.Lugnegard, T., Hallerback, M. U., Gillberg, C. (2011). Psychiatric comorbidity in young adults with a clinical diagnosis of Aspergers syndrome. Research in Developmental Disabilities, 32, 19101917.Greene, R. W., Biederman, J., Farone, S. U., Wilens, T. E., Mick, E., Blier, H. K. (1999). Further validation of social impairment as soothsayer of substance use disorders. Findings from a sample of siblings of boys with and without ADHD. Journal of Clinical Child Psychology, 28, 349354.Mahan, S., Matson, J. L. (2011). Children and adolescents with autism spectrum disorders copared to typically developing controls on the Behavioral Assessment system for children, Second Edition (BASC-2). Research in Autism Spectrum Disorders, 5, 230236.Matson, J. L., Wilkins, J. (2009). Psychometric testing methods for childrens social skills. Research in Developmental Disabilities, 30, 249274.Worley, J. A., Matson, J. L. (2011). Psychiatric symptoms in children diagnosed with an autism spectrum disorder An examination of gender differences. Research in Autism Spectrum Disorders, 3, 10861091.

Paradoxes and contradictions presented in Macbeth

Paradoxes and contradictions presented in Macbeth Paradoxes and contradictions (foul and attractive, and so on) presented in Macbeth In William Shakespeares calamity, Macbeth, readers are introduced to a harsh human being of war, carrying into action and treachery. At the beginning of the play three witches tell Macbeth that in his life cartridge clip he will become Thane of Glamis, Thane of Cawdor, as well as the superpower of Scotland. At prototypal Macbeth is slow to believe the prediction of the witches, but after(prenominal) the first cardinal prophecies come to fruition Macbeth becomes power hungry. Through by the swordplay readers see both the rise and fall of Macbeth. Macbeths coming to power, through soul-destroying and immoral means, creates a orbit of mis self-confidence in most, if not all, characters. Shakespeare exploits this world of uncertainty and barbarous by adding many contradictions and paradoxes pertaining to self-assertion and dimness. After the authentic murder of Duncan in Macbeths castle characters become very uneasy because thither is obviously a traitor among them. Trust becomes a big sleep together among those in the castle, and others concerned for the well being of Scotland. Shakespeare emphasizes the trust versus mistrust contract by using specific literary devices. In the very first scene one of the witches utters the famous paradox, Fair is foul and foul is fair (1.1.) This paradox means that appearances can be very deceiving and thither is finely line between good/evil and trust/mistrust. Before the murder of Duncan Macbeth has an Gillis 2internal battle with his conscience, he reflects on the fact that Duncan is here in double trust. There are in fact two reasons for him to be protecting the King. He says, Hes here in double trust/ First, as I am his kinsman and his subject,/ Strong both against the statute title then, as his host,/ Who should against his murderer shut the door,/ Not bear the knife mysel f. (1.7.). Ultimately Macbeths leap ambition(1.7) overrides his conscience and he does murder Duncan in his own castle. After the deed is committed Macbeth panics. He sees ghosts and believes that he will never sleep again. skirt Macbeth reminds him that he must keep remain calm and entomb his sin to maintain the trust of the other members of the Kings party. False face must hide what the false heart doth know(1.7.). Hiding the truth is Macbeth and Lady Macbeth main focus, on with attempting to murder anyone who stands in the air of the continuation of their royal linage. The question of who to trust is also seen when Macduff travels to England to seek the help of Malcolm, Malcolm tests him by making himself out to be a tyrant that has no interest in kingly duties and MacDuff reacts with despair, O my breast,/ Thy hope ends here(4.3.) Malcolm then decides that MacDuff is indeed a loyal champion of Scotland and he may trust him. The uneasiness of the characters is amplified b y Shakespeares emphasis on trust. It is extremely difficult to tell your friends from your enemies when a traitor is among them. Shakespeare also uses illuminate and darkness to enhance the images of good and evil throughout the play. Macbeth often makes speech to darkness as if he is shamefully trying to run out and hide from his thoughts and actions. Even before the murder of Duncan he feels guilty. Macbeth says, Stars hide your fires,/ permit not dizzy see my black Gillis 3and deepest desires(1.4.) The darkness of the shadow is then embraced my both Macbeth and Lady Macbeth as they attempt to hide their evil deeds from the public eye. It seems as though the characters in Macbeth believe that the loom of darkness is needed when committing acts of violence and corruption. The witches are also associated with darkness. Banquo refers to them as instruments of darkness (1.3) and Macbeth calls them secret, black, and midnight hags(4.1) These references give readers a sense th at the witches are mischievous and evil sort of than simply the messengers of good news and predictors of great fortunes. The darkness also seems to obscure the lines between reality and the supernatural. All of the appearances of the witches occur during the night deep in the wood, where it is hard to tell reality apart from a paranoid imagination. The light and your eyes may play tricks on you causing you to think or believe something fictional. This is why Shakespeare only had the witches materialize under these circumstances, to enhance the picture of the supernatural. Light is also used as a metaphor for life. In Macbeths final soliloquy he says, And all our yesterdays have lighted fools/ The way to dusty death. Out, out brief candle (5.5.) Shakespeare compares life to the flame of a candle. The candle can be extinguished easily and in the specious scheme of things it only burns for a tremendously small come up of time. It does not matter how long the candle has been bur ning it can be blown out at any point. This is an especially interesting analogy because those murdered in Macbeth are of all ages, from King Duncan to Macduffs children. Throughout this tragedy Shakespeare uses many literary devices to make certain aspects of his writing stand out to the reader. The paradoxes, contradictions and metaphorsGillis 4 used in Macbeth constructed a sort of onstage world where it is impossible to trust anyone. At any point there could be someone hidden in the darkness ready to take your life. Scotland has been enveloped in a shadow of darkness, and the result is disorder, chaos and murder.

The History Of Incidental Advertising Exposure Psychology Essay

The History Of sequent Advertising Exposure Psychology EssayFollowing the suggestion, the cause of peripheral advertize will be controld in endpoints of con nonative memories (cognitive responses), perceptions and attitudes (affective responses) and precondition set (behavioural responses). The endogenous variables consist of accompanimentors that, as consumer traits, affect the whole advertise response bear on. Among various factors, involvement and cognitive style were deuce head develop psychological variables that crop consumers incident ad execute, temporary hookup gender was considered an historic demographic variable. Comparing to the meta-analytic archetype, we choose to introduce two in the raw variables that were never been tested in the mise en scene of sequential advertising gender and cognitive style.III.2. Incidental advertising mental pictureFerraro, Chartrand and Fitzsimons (2005) designate sequent flick as an automatic process of optical c heck selective entropy while assured attention is directed elsewhere. Vanhuele et al. (2005) talked astir(predicate) focal versus non-focal attention in the strip of visual perception. Focal visual sense is restricted to 1,5 to 5 academic degrees from the current stopover of focus. To define it, Shapiro (1999) suggests that while a person spot timids informed attention on a prime task, other(a) in imageation that is non attended to dope be processed. This nonconscious, serial exposure very much occurs without clear reminiscence for ad, carrefour, or marketing stimuli and pot affect persuasion. Scholars c all(prenominal) incidental advertising by preattentive advertising (Droulers, 2004, Yoo, 2005, Adams, 2007). This preattentive impact can be distinguished from attentive bear upon in indivi forkeds lack of aw arness of the stimuli, deficit of a specic close for the process, inability to control the process, and attention resources non required for the proce ss. More specically, preattentive impact occurs when an individual is preconscious exposed to comment in his peripheral eld of vision (e.g., banner advertisements) while focusing his attention on a primary task (e.g., reading an article on the web) (Ruy and al, 2006).In the theater of advertising Shapiro, McInnis and Heckler (1997) were the first to propose the incidental exposure paradigm where they contract that subjects be directed to focus their attention on primary task, because reducing the resources accessible to process tributary data b fix uping the primary info. In most cases, the secondary culture is located to the left or the full of the primary discipline and is described by its distance (in degrees) from the primary in formation (parafoveal is 1.5-5 degrees from the attended information, peripheral is great than 5 degrees) (Janiszewski, 1988). Attentional resources available for process the secondary information ar limited, so secondary information cann ot be subjectdly recognised- reposition depicts for this information argon un the likely to be strong lavish to be restored during a direct search for repositing. When reading a newspaper, subjects argon inable to recognise having previously seen the ads, Janiszewski (1988) has shown, however that this exposure can boost a consumers liking for the ads and brands. Some marketing studies acquit investigated conditions that facilitate bear upon of secondary information (Janiszewski, 1993), the proceeding this processing has on the comprehension of focally attended material (Janiszewski, 1990), and why this processing affects ad attitudes (Janiszewski, 1993, Shapiro and McInnis, 1992). foregoing explore has attributed incidental advertising exposure effects to perceptual eloquence arising from a ingest depth psychology that occurs during exposure (Janiszewski, 1993 Shapiro et al., 1997). It is necessary to review the process by which preattentive processing whitethorn facilit ate individuals responses. Two underlying mechanisms debate up been suggested feature and semantic analysis. Both analysis mechanisms during preattentive processing will be briefly discussed ingest analysis Perceptual eloquence asserts that when exposure leads to a reposition trace for the perceptual features of the stimulus (e.g., shape and b compensateness), the features of the stimulus are much(prenominal) easy processed on a attendant occasion. Without explicit entrepot for having only seen the stimulus, this ease in processing is misattributed as an increase in familiarity and/or preference for the stimulus (Bornstein, 1989). Perceptual volubility whitethorn be discovered as the ease of processing the perceptual features of a stimulus (Jacoby and Kelley, 1987). Prior exposure is thought to create a feature anchor representation of the stimulus in repositing, with the resolvent that processing of the stimulus on subsequent encounters is facilitated and experi enced as subjective ease. Shapiro, McInnis and Heckler (1997) indicate that the effects of incidental ad exposure on stimulus-based judgements (attitude judgements made in the presence of an ad or brand) are due at feature analysis that occurs during processing (Janiszewski, 1993). This processing drop outs secondary information to subsequently be perceived more than(prenominal) easily and hence thought to be more familiar, evaluated more highly. When a person builds a mental representation of a distinguishing item, any turn up processing takes place faster and, in many situations, lets the messages give the embossment more appealing and entire than they would be if they were crucial or perturbed to process (Reber and Schwarz, 1999).Furthermore, Bornstein and DAgostino (1994) construed the likeability of more readily accessible information conceding to a cognitive perceptual fluency/misattribution deterrent example, whereas Winkielman and Cacioppo (2001) suggest a hedonistic fluency model that ascertains constructing smoothly positive affective responses toward fluently processed stimuli. Referring to hedonistic fluency, benignant and affirmative senseal responses happen in consequence of the fact that inclined stimuli frequently signify a harm little situation, successful. Re apprehension generates good cutaneous sensess and clear interpretation attends to positive mood. Janiszewski (1993) further leads the hemispheric cash advance to the branch of incidental advertising exposure and discerns that abonded communicatory messages are more persuasive when they break through on the ripe side of the chief area, but they convince wanting(p) to visual cues if they are located on the left.Rendering to Janiszewski (1993) explanations of secondary messages are actuated chiefly by feature analysis, which contains the recognition and processing of the perceptual features of the stimulus in the subconscious mind (Shapiro, 1999). Therefore, when more or less(prenominal) test and visual stimuli appears to the left of focal point, viewers hotshots naturally accredit more subject matter to treat the visual cues, which commences in higher acquaintance and likeability for the visual messages during ensuing confrontations. However McQuarrie and Mick (2003) found that incidentally exposed with ads figures produce more favourable attitudes and improved repositing, whereas Clark and Brock(1994) declare no significant effects of images in ensuing processed ad warnings, along with greater attitude alterations after the exposure to peripheral verbal warnings (Acar, 2007).Semantic analysis Although perceptual fluency relies on the encoding of feature information during exposure, an analogous process may occur if incidental ad exposure involves the processing of semantic information (Shapiro, 1997). A survey by Whittlesea (1993) shows that fluency effects can or else beyond instances of perceptual processing by demonstrating that semantic processing can lead to feelings of conceptual (vs. perceptual) fluency. Whittlesea (1993) suggests that conceptual fluency will affect any judgement regarding a stimulus that relies on conceptually based processes, such(prenominal) as decisions of semantic relatedness. It was mentioned previously that perceptual enhancement may be used as a criterion for de borderining inclusion in a consideration set. The predominant surmisal accounting for this facilitation effect suggests that contextual scene information activates a schema for the theme or issue of a scene prior to purpose identification.The activated schema in turn creates expectancies about what objects are likely to be present. These expectations facilitate object identification (Shapiro, 1997). Di pace et al. (1991) found incidental semantic priming effects after 200milliseconds but not after 2,000 milliseconds. This supported their notion that automatic, non wise to(p) semantic processing of parafoveal information is v ery short lived (Shapiro, McInnis, Heckler, 1997). In his research, Shapiro (1999) concludes that ad information can undergo a semantic analysis during incidental exposure. Advertised crossroads can more easily take advantage of this analysis when they are depicted in a consistent scene. When advertised products are depicted in this fashion, incidental ad exposure leads to conceptual fluency effects, exerting unconscious ad influence during consideration set formation. When a product is depicted by itself, unconscious ad influences rely on a feature analysis that occurs during exposure. This analysis creates perceptual fluency effects.The results of experiments in Shapiros (1999) study showed that subjects in the context condition had greater levels of unconscious ad influence and those in the no context condition. This demonstrated that semantic relatedness between the product and other contextual ad information affects oppositeially the likelihood that the products account woul d be activated in recollection, and, hence, the likelihood that the advertised product would be included in consideration set. This suggests that semantic processing of contextual ad information is what accounts for the context facilitations effects.In our work, we refer to one of the major theories that pardon the effects of incidental advertising which is the theory of Zajonc (1968) called unadulterated exposure and subconscious processing. In fact, Zajonc (1968) defines the mere exposure effect as the contemplation that mere ingeminate exposure of individual to a stimulus is a sufficient condition for the improvement of his attitude toward it. By mere exposure is meant a condition which just makes the given stimulus attainable to the individuals perception. It arises when repeated or single exposure to a stimulus, even in the absence seizure of acquaintance, results in the formation of a positive affective reaction to the stimulus (Zajonc, 1968). In another side, Janiszewsk i (1993) defines mere exposure to a brand advert or product package as the process that encourages a consumer to call for a more favourable attitude toward the brand, even when the consumer cannot recollect the basic exposure.This theory is interesting for our study as Zajonc (1968) found that as tote up of exposure increased, so too did the favourable ratings. Bornstein, Leone and Galley (1987) get down okay these effects when participants are aware as well as not of the presence of stimuli. Further, Ye and Raaij (1997) suggested another exposition of mere exposure as they get hold of that the mere-exposure effect in the absence of awareness represents unquestioning stock. Mere exposure is the formation of a positive affective reaction to repeated or single exposure to a stimulus, even in the absence of awareness. Bronstein (1989) exposes that research on the influence of repeated stimulus exposures has demonstrated that preferences can be create without an accompanying awareness of the preference formation process. Thus, there was a positive affective reaction to the previously presented stimuli (as assessed by their preference judgements) in spite of the fact that these stimuli had not been perceived consciously.Another major theory that explains the effects of incidental advertising is the theory of hemispheric processing styles. In reality, many a myth has advanced around the brains asymmetry. The left noetic cerebral hemisphere is supposed to be the calculatedly logical, verbal and governing half of the brain, while the right is the utopian side, perceptional, spatially aware but suppressed (McCrone, 2000). recording to this theory, the human visual trunk is organized as stimuli located within the individuals guinea pig of foveal vision, roughly 1.5 degrees to the left or right of the current field of focus are initially sent to the right hemisphere for processing, and stimuli put to the right hemisphere for altering, and stimuli laid to the current field of focus are originally sent to the left hemisphere. This theory suggests that summing information to support verbal claims in an advertisement may influence the subconscious processing of the claims. Janiszewski (1990) affirms that processing style refers to the procedure or process each hemisphere uses when assail to carry through a task. Hemispheric resource theory predicts that the availability of resources to form a shop trace of the outputs of a feature analysis may be sensitive to an activation created by the feature analysis its self.To excavate the effects of incidental exposure to advertising, Janiszewski (1990) recommends the cooperative interaction model which is based on two hypotheses that affect directly to the problems of a dual dodge processing system. The first is that the brain is reciprocal, parallel processor-each hemisphere has its own item-by-item bank of resources and each hemisphere is able of involving concurrently in sixfold ope rations (Janiszewski, 1990).The second assumptions that the hemispheres collaborate cooperatively (Allen, 1983).The assumptions of the cooperative interaction model can be applied to anticipate how nonattended material might talk damage with the apprehension of an unattended verbal messages (Janiszewski, 1990).The model is based on talent theories of attention ( Broadbent 1971 Kahneman, 1973) as well as on general models of information processing, in which motivation, competency and opportunity factors affecting message processing are synthesized (MacInnis and Jaworski 1990). A key belief underlying these theories and models is that the attentional faculty (or processing capacity) that is accessible to a consumer at a distinct point in time is limited, and that the part that is designated to the stimulus canvas is a function of both exogenous (opportunity) and endogenous factors (motivation and ability). The autonomy versus cognition mediation controversy has tally to an impasse and has been surpassed by the rise of perceptual fluency as a popular account of the mere exposure effect.Consistently, Wang et al. (2002) found that placing a brand name to the right of attended pictorial information should send it to the less activated left hemisphere, where it will receive a greater degree of subconscious processing than if sent to the right hemisphere. The possibility that placement influences evaluation of a peripherally placed stimulus stems from the scheme that the hemispheres accept diverse processing styles. The differential competency of the left and right hemisphere for forming a mental representation of a stimulus during a preattentive processing has a direct implication for our take ining of one potential benefit from manipulating the fixing of the incidental ads. Thats why we adopt this theory. In fact, referring to the works of Janiszewski (1988, 1993, and 1999) we suppose that ads were more liked when placed in the left, as opposed to the right , visual field because this draft encouraged the viewer to use the holistic processing resources of the right hemisphere to initially. This theory is very ancient, many researchers adopted it and even neuroscientists have supported it. Neuroscientists affirmed, in fact, the distinction between the processing that occurs in the right hemisphere and left hemisphere. In this study we fix that incidental ads placed in the left were more liked.III.3. Implicit memoryOne of the Copernican cognitive responses are memories. A large number of studies have studied memory for advertisement. Yoo (2005) revealed that prior lit in memory research suggests that when consumers are exposed to an advertisement, multiple representations of the advertisement are encoded in memory. In this study, we give a great importance in studying the memory. In fact, to understand how unconscious advertising affects consumer preference, it is first necessary to understand something about how consumers think. exac tly previously marketing studies examining memory for advertisements have relied approximately wholly on examining effects contingent on explicit memory retrieval. In psychology, memory is an organisms ability to store, retain, and recall information.Kronlund, Whittlesea and Yoon (2001) define memory as the commander of all acquired human behaviour, containing speech, conceptual apprehension, skilled activities, social interactions, and consumer preferences. In another side, neuroscientists define memory as the retention of learned information, the acquisition, storage and retrieval of information. To achieve a true discretion of any aspect of human behaviour, it is therefore essential to have an effective theory of memory. In fact, extant literary works offers strong evidence that product judgement and brand choice decisions are often influenced by information retrieved from memory (Alba and Hutchinson, and Lynch, 1992).One type of memory that emerges from an exposure out get in to is explicit memory (Yoo, 2005). At the time of exposure, a depiction of the information is encoded in memory and is correlated with a spatio-temporal context that attaches the information to the exposure incident. This memory depiction is attributed to as explicit memory, as known as episodic memory. Explicit memory is characterised by a persons conscious recall of the event and replies what he or she esteems about the event (Lee, 2002). Its also, characterized by a respondents conscious recollection of the preceding exposure. Thus measures of explicit memory make direct reference to the past exposure, and suspects are interrogated to demonstrate what they can remember about the prior event (Yoo, 2007). In fact, Bertrand and Girardi (2007) reveal that explicit memory codifies information on autobiographical events, moreover friendship of facts. Its creation builds upon cognitive processes of the evaluation, conflicting and take for granted type. Implicit memory has an un blue scratchal and impulsive attribute, and its formation and recall are not entirely unfree on the aptitude of having or attaining knowledge of cognitive processes (Lee, 2002).Cooper and Schacter (1992) delimit implicit memory as nonintentional, nonconscious retrieval of previously acquired information and is demonstrated by enhanced performance on tests that do not require conscious recollection of the past. Explicit memory on the other hand, requires intentional, conscious recollection of the past. The difference between implicit and explicit memory in terms of nonconscious and conscious retrospection is enigmatic because these put ups of soul loss accepted defining criteria. However, the term implicit memory was hypothesize by Graf and Schacter (1985), with attributing to the phenomenon of remembering without awareness (Lee, 2001). Implicit memory is analyzed to be revealed by relief in tasks that use memory whereas explicit memory is affirmed by straight testing memory (Jacoby , 1991). This memory is unallied of cognitive resource, acts constantly and inevitably whether we are paying a lot or a little attention or even no attention at all, and is able of attaching feelingal meaning to anything that it perceives (Heath, 2007). Our interest to study those memories comes from the fact that Shapiro, McInnis and Heckler (1997) advice that the presence of unconscious processing would be indicated by two measures (1) implicit memory for the object brand names (2) no apocalypse of explicit memory of the target ad (Yoo, 2005).Berry and Dienes (1993) affirm that in the case of incidental advertising, contextual knowledge is acquired through implicit attaining processes which bear complicated information about the stimulus environment to be without intention or awareness. They supplementary propose that incidentally acquired contextual knowledge forms a highly robust, instance based and implicit memory for context. The favour of implicit learning is that permits more information to be acquired than is possible through consciously concerned channels. The capital advantage of implicit learning is that it may allow cognitive systems to memorize more information about stimuli than can be processed through consciously controlled channels (Lewicki et al., 1988).Jacoby and Dallas (1981) define the facility with which a person recognise the physical characteristics of a stimulus as perceptual fluency and is identified to be enhanced through preceding exposures. Especially, empiric proof from implicit memory research arrays that prior exposure to a target of ten benefits task performances such as lexical decision, word completion and anagram solving that involves the identification of the perceptual features of the target (Lee and Labroo, 2002). They report that conceptual fluency eases consideration-set membership and memory based-choice as the result of all-encompassing accessibility of the brand in memory (Lee, 2002, Nedungadi, 1990, Shapiro, McInnis and Heckler, 1997) and they lead to the apprehending of the processing fluency model by showing that conceptual fluency influence judgements, too. raise performance has been examined even when respondents are not aware of their having been exposed to the information earlier. Enhanced performance as the termination of preceding exposure recommends that masses have memory of the exposure event, even though they may not consciously remember it. This enhancement reflects implicit memory of the event and is often mentioned to as priming. According to the cue accessibility hypothesis, an sensation may effect ones evaluations of ad stimuli because materials stored in memory that are conforming that emotion state will be more available, and consequently more likely to come to mind then they would at another time.Current findings in the mere exposure literature show that perceptual fluency is positively valenced, then peoples assessment of an object grows as it becomes perceptually more fluent. Extended literature has displayed that the level of attention in encoding does not affect implicit memory but actively influences explicit memory. Schacter (1987) check out numerous alternative theoretical clarifications of such dissociations. One explanation, the activation view, holds that implicit memory performance rests on concepts that are briefly activated in memory due to the antecedent exposure (Yoo, 2007).One of the theories conducted in the field of neuroscience is the competence hemispheric theory. This theory recommends that memory traces are essential to bring the order in which material is presented. The right hemisphere has a more accurate performance of sequentially presented events because it does not commonly essay to reconfigure information as does the left hemisphere (Janiszewski, 1990). The left hemisphere sounds more able to process written or verbal ads, where as the right part of the brain triumph at visual ads. Janiszewski (1990) support Fried man and Polsons matching activation hypothesis and suggests that the greater activation of the right (left) hemisphere during the processing of attended pictorial(verbal) information should improve processing of supplementary material represented within the left(right) hemisphere provided that the material in opposing hemisphere can be handle by that hemisphere.During preattentive processing, if individuals bank only on perceptual fluency (feature analysis), their responses should be independant to the advertisement message, if indeed the individuals are knowledgeable only of features (e.g. size, color) in gull advertising. However, if semantic analysis is possible, cognitive responses may implicitly embody the advertisement message, such as a brand name or baronial message cues, even though individuals do not explicitly remember them. Sine this research predicted that semantic analysis is also struggled during preattentive processing, it is anticipated that individuals have impl icit memories of print advertisement message as a result of preattentive processing. Processing a print advertisement in a preattentive musical mode will notify the brand delineated within the advertisement and thus construct an implicit memory trace for the brand, even though an individuals explicit memories for of the advertisement will be at levels no greater than those awaited by chance (Raman and Leckenby, 1998). Based on the above discussion and the results of antecedent studies, the first hypothesis is suggestedHypothesis 1. Incidental processed advertising is more likely to generate implicit memory than that expected by chance.III.4. ablaze responsesUntil now, there is no scientific and precise definition of the term emotion. In colloquial language, the term is used to refer to feelings and moods and also refers to the agency these are expressed both in behaviour and bodily answers (Kandel Schwartz and Jess ell, 2000). The Longman Dictionary definition of emotion is str ong feeling (e.g. anger, fear, joy) usually incorporating physiological change (1984). Further, fit to the complete Oxford English Dictionary, in a psychological classification the term emotion refers to a mental feeling or affection (e.g. of pastime or pain, desire or aversion, surprise, hope or fear, etc.) as distinguished from cognitive or volitional states or consciousness also abstr feeling as distinguished from the other classes of mental phenomena (OED, 1994 version). Far from the traditional approach to the study, the cognition accentuates information processing of view that has generally excluded emotion. In contrast, the youthful emergence of cognitive neuroscience as an inspiration for understanding human cognition has stressed its interaction with emotion. An understanding of human cognition requires the consideration of emotion. query in neuroscience has resulted in a definition that is distinct from feeling. In contemporary neurological research, emotions are uncon scious processes, occurring in the inner and most stark(a) parts of the brain.Damasio (2003) have written that emotions play out in the planetary house of the body so by contrast feelings play out in the theatre of the body. To understand the effects of incidental advertising on emotion we refer to the works of neuroscientists. In fact, decision neuroscience offers the commitment of deepening our understanding of emotion and decision making in a number of ways. Neuroscientists like Damasio and Le Doux have shed a great deal of light on the critical habits that emotion plays in the brain (Damasio, 1994 Le Doux, 1996). Le Doux (2002) claims that emotion can be defined as the process by which the brain determines or computes the value of stimulus. Other aspects of emotion than duplicate from this computing (Meyer-Dinkgrfe, 2007). In his book, Descartes Error, Damasio declares that the French philosopher may have blow when he came up with his famous dictum, I think, therefore I am. Had Descartes understood the central role that emotions play in the workings of the mind, he may well have written, I feel, therefore I am (Plessis, 2005).Damasio (1994) can be swear with initiating modern thinking about how emotions are processed. He uses the concept of a limbic system in the mammalian brain, a construct develop by MacLean (1952) to represent the original mammalian brain, which lies beneath the more deep developed neo-cortex. He shows that employment in the proto-self always anticipated activity in core consciousness. This therefore means that emotions and feelings are always formed pre-cognitively (Heath, 2007). The role of emotion in mental processes is a matter of impetuous reflection, where Damasio (1994) argues for strong, but not unique, role for emotion within an exhibited nervous system in general. In particular, the research reviewed above confirms that ads victoriously appealing to the emotions are better remember than their cognitive cousins, althou gh very little is known about the mechanisms supporting the formation of the mad memories and their effects on consumer choices (Palessman, 2005).It is so cardinal to differentiate between the affective responses toward the stimulus and the global feelings. In this context, emotion represents specific feeling states at the time of incidental exposure. This goes with the definition of Batra and Holbrook (1987) who have distinguished emotional reactions from subcategories of affective responses toward the advertisement. We have also to distinguish emotion from moods. Different to moods, emotions are more stimulus particular (Cohen and Areni, 1991) and emotions may veer highly in their intensity level. Thus, emotions may impact the effectiveness of print ads differently than do moods (Mherabian and Russell, 1974).As there is a delay between the incidental advertising exposure and subsequent brand choice, memory processes ought to be important in determining the effectiveness of part icular kinds of advertising. We will examine in the experimental part the critical link between emotion and memory and look how this argues strongly for a dynamic understanding of the way emotion works as we process advertising. The findings of Percy (2003) suggest that in admittance to the words and visual images, we also store the emotions that are present at the time so when we recall that event, the emotions associated with it are also recalled whether we are conscious or unconscious of those feelings.Memory in particular, has been studied in terms of its relationship to affect by a number of researchers (Batra and Holbrook, 1987). Hall et al. (2006) stipulate that emotionally arousing the scenes are better remembered than neutral one so emotion has an impact of the memory formation. Events associated with emotions were found to be more memorable. Canli et al. (2000) have found that amygdala activation reflects moment-to-moment subjective emotional experience that this activati on enhances memory in relation to the emotional experience and that this activation enhances memory in relation to emotional intensity of experience. They discover also that memory for emotional stimuli and experiences varied the sexes women seem recalling emotional autobiographical events than men, produce memory with greater emotional intensity in response to cues.Always referring to neuroscience, it has been known for some time that the amygdala is a key brain region for the formation of emotional memories. Cognitive neuroscientists have begun recently to illuminate the psychological and flighty mechanisms underlying emotional holding of past events (Percy, 2003 Plessis, 2005). Emotion-memory interactions occur at some(prenominal) stages of information processing. By adopting the perspective of neuroscientists, we struggle to forward our understanding of the link emotion and memory. LaBar and Cabeza (2006) reported that emotion has authoritative influences on learning and memor y that comprise multiple brain systems engaged in at different stages of information processing. Further witness of the link between emotion and memory was provided by Ashby et al. (1999). They found that positive affect of individuals facilitates the reinforcement of long term memory as it systematically influences performance on many tasks their new neuropsychological theory postulate that accounts for many of these effects by assuming that positive affect is associated with increased brain dopamine levels.For Jacoby (1991), recognition memory is treated as dual process that includes recollection (a conscious, controlled process) and familiarity (an unconscious, automatic process). The dual process model stipulates that, for recognition, recollection acts as a discrete state and familiarity can be vi

Want to Sell a Website? The Process :: Sell Website

Selling a Website - The Process sign vendor meetings are conducted by the Sellers divisor (a profession onlyy trained bank line Broker, holding a Real Estate Agent license where necessary), and the Seller is educated on the process of selling a business. A delegacy discernment is filled out by the Sellers Broker & signed by the Seller. Immediately after signing the representation Agreement, the Seller provides the Broker the quest Complete lists of all equipment and new(prenominal) assets to be included or excluded in the sale Profit and loss statements, balance sheets, and tax returns of the Business masking the last three years The most recent interim get and loss statement, balance sheet, and sales tax returns Real and personal office leases Copies of all patents, licensees, loan documents, contracts or agreements All agreements relating to employee benefits Any environmental reports and Copies of all other documents needed to present a fair and accurate rendering of the Business to prospective buyers. During the representation period, seller go away provide periodic updates of each such document during the period of this agreement where any visible change has occurred. Seller consents to Broker publishing, advertising or distributing information well-nigh the Business to prospective purchasers and to cooperating brokers, and contacting landlords and any others regarding any of the information about the Business. Sellers Broker writes a narrative on the Business the Representation Agreement is entered into the Sunbelt proprietary database, and a Business Profile is created. Sellers Broker introduces the Business to all of our other brokers during weekly office meetings. All other brokers match the Sellers Business selective information (SBD) against Buyers in their respective queues (Buyers who obligate previously been interviewed, signed a Confidentiality Agreement and filled out a detailed Buyers Profile) Sellers Broker plans an advertising outline and the SBD is added to web sites in such a manner so the usual public cannot identify the business. Buyers in queue and Buyers who have responded from the advertisements exit have their backgrounds and finances evaluated to see if they are qualified Buyers. If qualified Buyers are interested, they will be shown a Business Profile. If further interest is shown, the Sellers Broker will arrange a meeting with the Seller. If a Buyer wants to make an invite at a fair price, the Buyers Brokerwill write the offer and secure a deposit. The Sellers Broker will present all offers to the Seller.

Comparing The Adventures of Huckleberry Finn and Tom Sawyer :: comparison compare contrast essays

The Adventures of Huckleberry Finn and tom sawyer beetle   Huckleberry Finn and Tom Sawyer argon the best of friends with remarkably different personalities. Each brings their unique characteristics into this eccentric friendship giving the novel numerous amusing passages. Throughout the tale, Tom is often the leader while Huck is the reluctant follower. It doesnt matter that Toms ideas are ridiculous and extravagant, and Hucks are simple and practical, together they always proceed with Toms chimerical plans. In contrast to Toms great imagination and creativity, Huck is humorless and vocal minded. Toms imaginativeness comes only from knowledge he has gained through books. Huck, on the another(prenominal) hand, actually lives out the fantasies Tom can only imagine. Tom Sawyer, already civilized, follows the values and beliefs of society. Due to these convictions, Tom always abides by the laws. For these reasons, Tom would never have helped free Jim unless he knew that Jim had already been freed. Conversely, Huck Finn rejects the philosophy of governmental beliefs for the fear of becoming civilized. He usually runs away at the commencement exercise notion of him becoming sivilized. Huck is able to function in either society with the help of his adaptability and survival skills. He is able to go from the license of the raft, to the perceived harshness of civilization, and back again with ease. Although Tom has been able to fall asleep past Deaths grip so far, his chances of escaping may not always wager out to his liking. Of the two, Huck will always be the survivor in life. Together this pair achieves their goals because of their intelligence and witty personalities. They have the ability to grade the knowledge they obtain into their every day lives. They are two swaggering souls in search of fresh and exhilarating escapades. Their ages united with their exceptional teaching keeps them on their toes. Hucks humorless pers onality and Toms extravagance has made

The Importance of the Tutor in The Flies :: Lord Flies Essays

The Importance of the handler in The Flies   In Jean -Paul Sartes play, The Flies, the main character Orestes manages to lift a iniquity that has plagued the dwellers of Argos for decades. Both the current king of Argos and Zeus himself are perpetuating this nemesis for as long as possible for the curse keeps the people subservient and in a state of mourning and terror of their own actions two things that twain the king and Zeus favor in their rule over people. Orestes was actually a resident of Argos and is the first child of the Queen M opposite and the idle king. He returns to Argos with a traveling companion, the Tutor, who used to be the childs teacher in the ways of the world. Now the man is Orestes slave and close advisor. Orestes stance towards the Tutor and their past relationship essentially effects his ability to break the curse in Argos.   In a completely literary sense he was both a counselor for Orestes and a sort of Narrator to foregather in holes in d ialogue and the story line. Orestes background was the foundation for his decision-making in this play and Sartre had to find a way to let the audience realize what this background was, not only for a linear and complete plot, merely also as a testament to the thoughts themselves. The Tutor completed his usance in both senses, tying the plot together at the branch and the very end, and also moving the story along with gifts of advice and observations to Orestes. He close in a sense doesnt belong in the play. He is a complete contrast to all of the other characters other than maybe Orestes himself. And yet he seems to be a part of Orestes, like his conscious, his voice of indicate in this whole tribulation. As a character, the Tutor is much more(prenominal) complicated than one might assume upon first glance.   The Tutor as a person was fairly simple in his wisdom and ideas. He had no delusions, no emotional or religious ties, and no truth other than simple and deductive logic. As for personality traits, he was a skeptic, an atheist, and serve up a kind of detachment from the world and its people. He is an admitted skeptic of the world, revealing Orestes that he had been trained in skeptic irony (61).

Caesar and Cleopatras Affair at the Expense of Calphurnia :: Caesar Cleopatra Papers

Caesar and Cleopatras thing at the Expense of Calphurnia knock off In the trailer to his 1934 film Cleopatra, Cecil B. DeM strokee confidently suggests that the romance between the coffin nail of Egypt and Julius Caesar is one of historys grandest love single-valued functions. Perhaps this statement is in a delegacy true, but when buying into the tradition of this romance many disreputable elements of the combat atomic number 18 often overlooked. One such component of the romance that if looked upon with a slender eye can serve to lessen the grandeur of the affair is the charge treatment of Caesars wife Calphurnia. However, audiences and artists alike often have little occupation ignoring the plight of Calphurnia, and Caesar and Cleopatra argon rarely ever referred to as adulterous individuals. Neglecting to guess how Calpurnia was virtually thrown to the trackside in the midst of Caesar and Cleopatras extra-marital relationship is mayhap a way of lessening the guilt felt by those who favour to become surrounded by the supposed splendor of Caesars love affair with the Egyptian fay. Those who accept to proclaim the glory of Caesar and Cleopatra must be cautioned to memorialise Calphurnias situation as an abandoned and insulted wife. If attention is given to faithful Calphurnias apostasy by Caesar and inferior treatment by Cleopatra, it becomes evident that Calphurnia is deserving of benignity while Caesar and Cleopatras relationship is not so grand and sophisticated as many wish to think. Faithful CalphurniaHistory tells us that Calphurnia invested twelve long quantify of her life in wedlock to Caesar. Although a political marriage, Calphurnia treated Caesar with a caring attitude and loving attachment which legitimizes their relationship and for which she deserves respect. The most grave times of Calphurnias faithfulness toward her husband is her care for his safety in the utmost long time before his assassination, regardless of her being aware of Caesars adultery. According to Arthur Kahns historic narrative The Education of Julius Caesar, Caesar had grown gaunt and haggard as he lost the support of his colleagues in the Roman Senate. In his nett geezerhood he often stared into space and spoke with little coherence. In his time of need Calphurnia glued herself to his bedside and although Caesar could not make conversation with anyone, Calphurnia listened attentively as he recited Homers poems of Odysseus after he had returned home to Penelope.1 This narrative illustrates the luxury Julius had to face on his dedicated Roman wife in times of need.Caesar and Cleopatras Affair at the Expense of Calphurnia Caesar Cleopatra PapersCaesar and Cleopatras Affair at the Expense of Calphurnia abstract In the trailer to his 1934 film Cleopatra, Cecil B. DeMille confidently suggests that the romance between the Queen of Egypt and Julius Caesar is one of historys grandest love affairs. Perhaps this statement is in a way tru e, but when buying into the tradition of this romance many disreputable elements of the affair are often overlooked. One such component of the romance that if looked upon with a life-sustaining eye can serve to lessen the grandeur of the affair is the ill treatment of Caesars wife Calphurnia. However, audiences and artists alike often have little hassle ignoring the plight of Calphurnia, and Caesar and Cleopatra are rarely ever referred to as adulterous individuals. Neglecting to recall how Calpurnia was virtually thrown to the wayside in the midst of Caesar and Cleopatras extra-marital relationship is mayhap a way of lessening the guilt felt by those who choose to become surrounded by the supposed splendor of Caesars love affair with the Egyptian Queen. Those who choose to proclaim the glory of Caesar and Cleopatra must be cautioned to reckon Calphurnias situation as an abandoned and insulted wife. If attention is given to faithful Calphurnias forsaking by Caesar and inferior treatment by Cleopatra, it becomes evident that Calphurnia is deserving of savvy while Caesar and Cleopatras relationship is not so grand and sophisticated as many wish to think. Faithful CalphurniaHistory tells us that Calphurnia invested twelve long time of her life in wedlock to Caesar. Although a political marriage, Calphurnia treated Caesar with a caring attitude and loving attachment which legitimizes their relationship and for which she deserves respect. The most coitus times of Calphurnias faithfulness toward her husband is her care for his safety in the final days before his assassination, regardless of her being aware of Caesars adultery. According to Arthur Kahns diachronic narrative The Education of Julius Caesar, Caesar had grown gaunt and haggard as he lost the support of his colleagues in the Roman Senate. In his final days he often stared into space and spoke with little coherence. In his time of need Calphurnia glued herself to his bedside and although Caesar cou ld not make conversation with anyone, Calphurnia listened attentively as he recited Homers poems of Odysseus after he had returned home to Penelope.1 This narrative illustrates the luxury Julius had to opine on his dedicated Roman wife in times of need.

Do Credit Problems Lead to Bankruptcy Essay -- essays papers

Do Credit Problems Lead to Bankruptcy The reasons we as Americans buy on recognition varies, but without it most of us would believably never be able to purchase necessities such as a home or automobile. The nations economy depends on credit the promise to buy off later for goods and services used today. But along with consumer credit comes consumer debt. With the mount in telemarketing and commercializing in America it is no wonder why Americans feel the impulse to buy now, cover later. The most common progress to of consumer debt is episode debt, which is when a consumer borrows the money to purchase an item and agrees to repay the contribute in equal installments over a fixed period of time. Without installment debt most consumers could not afford to purchase items such as a home. The truth of the matter is that we, as Americans, tend to want to purchase more than than we can afford to purchase when we want it. But, we can afford to pay it out, over time, in fixe d payments. Mortgages, a debt owed on real property, ar the latest form of installment debt. Other forms include automobile loans and credit card purchases. Just pick up the newspaper any time after Christmas and you will find articles on managing your mounting debt from Christmas. Not realizing the conclusion of the consumers debt is one of the most common types of credit problems. Denial may bring a partial role in this problem, but the lack of information seems to be the largest reason for consumer debt. Cre...

Inside the Cuckoos Nest Essay -- Film

ace Flew every key the Cuckoos Nest is a film directed by Czech Milos Forman in 1975. Using potent elements of fiction--characters, conflict, and symbolism--Forman illustrates the counterculture of the 1960s. This film depicts American orderliness as an insane asylum that demands conformity from its citizens. The film begins with a calculating convict being assigned to the asylum. R. P. McMurphy is sent to the asylum to be evaluated by the doctors and to determine whether or not he is mentally ill. He is unsuspecting that he will be supervised by an emasculating woman named deem Mildred Ratched who watches the diligents every motion from her nurses station.R.P. McMurphy is a lively, rebellious, and rational patient that has recently been escorted into the insane asylum. Once in the bin, Randle becomes the self-proclaimed champion of the rights of the other screen patients, his adversary being bind Ratched ( saucily York Times). He scrutinizes the asylum and the patients deci ding that he needs to lighten the atmosphere. According to Filmsite, Movie Review McMurphy encourages the patients to participate in activities that will heighten their spirits and change their monotonous routines. McMurphy decides to challenge Nurse Ratched when he notices that the patients of the ward are overly organized and controlled through a rigid set of authoritarian rules and regulations that McMurphy questions God Almighty, shes got you guys comin or goin. What do you think she is, some kind of champ or somethin?--- I act as in one week, I can put a tease apart so far up her ass, she dont know whether to st or wind her wrist watch (OFOTCN). Entertainment periodic implies that McMurphy is unwilling to surrender to Nurse Ratcheds belittling power and rebels against corr... ...ok place in America all have one thing in common with the film they are filled with people who have had large and had a attracter willing to take leadership towards making that change. McMurphy represents that leader as his sacrifice made way for the others to find freedom.Works CitedCanby, Vincent. nytimes.com. The New York Times. 20 November 1975. The New York Times Company. 5 April 2012.Filmsite Movie Review One Flew Over the Cuckoos Nest.. Filmsite.org. American Movie Classics Company. 2012. Web 12 March 2012.Movie Reviews One Flew Over the Cuckoos Nest. Rogerebert.com. simoleons Sun-TimesMedia Company. Web 3 April 2012.Nashawaty, Chris. Cuckoos Nest Turns 35. Entertainment periodic 1120/1121 (2010) 128. MAS Ultra School Edition. Web. 5 Apr. 2012One Flew Over the Cuckoos Nest. Dir. Milos Forman. Warner Brothers, 1975 Film.